Logo UFABC

Login

Pregões de Atas SRP - Universidade Federal do ABC

Dados da Ata

Número processo: 23006.000969/2009-72

Número pregão: 00000204/2009

Data inicial: 12/01/2010

Data final: 11/01/2011

Autor: Tatiane Nascimento

Data elaboração: 22/10/2010

Última alteração efetuada por:

Data e hora da última alteração: Terça, 29 de Janeiro de 2013, 15:35

Observação: CONSUMO. Reagentes Químicos.

Itens
Descrição Descrição complementar CATMAT Fornecedor Valor Unitário (R$) Qtde contratada Unidade Qtde restante Valor total comprado(R$) Compras do item
14 MERCAPTOETANOL, LÍQUIDO INCOLOR, ODOR DESAGRADÁVEL, C2H6SO, 78,13 G/MOL, PUREZA MÍNIMA DE 99%, REAGENTE P/ SÍNTESE, CAS 60-24-2 BR00526 CER BRASIL IMPORTACAO E EXPORTACAO S.A. 110.00 5 Frasco 500ml 0 550.00 Exibir
66 ANTICORPO ALEXA FLÚOR 448 ANTI-HUMAN CD105-100STS BR00070 DBR COMERCIO E IMPORTACAO DE MATERIAL MEDICO HOSPITALAR 1498.00 2 Kit p/100 testes 2 0.00
70 ANTICORPO AF 647 FIBROBLAST MARKER, ALEXA FLÚOR, 100 MG/2ML BR00069 DBR COMERCIO E IMPORTACAO DE MATERIAL MEDICO HOSPITALAR 1411.00 2 Frasco 2ml 0 2822.00 Exibir
34 ENZIMA, TAQ DNA POLIMERASE, LÍQUIDO, FRASCO SEPARADO DE MGCL2, 5.000 UI/ML, TAMPÃO REAÇÃO 10X SEM MGCL2 BR00376 LUDWIG BIOTECNOLOGIA LTDA 150.00 4 Frasco 500un 4 0.00
76 SORO FETAL BOVINO, ESTÉRIL E INATIVADO, ISENTO DE MICOPLASMA E OUTROS AGENTES CONTAMINANTES, EMBALAGEM PET COM 500 ML BR00724 LUDWIG BIOTECNOLOGIA LTDA 207.00 6 Frasco 500ml 4 414.00 Exibir
55 N,N-METILENOBISACRILAMIDA, PARA BIOLOGIA MOLECULAR PUREZA ACIMA DE 98%, SINONIMO :BIS , CAS NUMBER:110-26-9, QUANTIDADE REQUERIDA: 500 G. BR00547 LUDWIG BIOTECNOLOGIA LTDA 1009.99 2 Frasco 500g 0 2019.98 Exibir
51 RESINA DEAE– SEPHADEX® A-50 40-120 ΜM, SINÔNIMOS: 2-(DIETHYLAMINO)ETHYL-SEPHADEX®, SEPHADEX® DEAE A-50, CAS NUMBER:39455-31-7, TAMANHO DA PARTÍCULA: 40-120 ΜM BR00677 LUDWIG BIOTECNOLOGIA LTDA 8827.50 2 Frasco 500g 0 17655.00 Exibir
43 ENZIMA DE RESTRIÇÃO, BAM HI, 10 UN/MCL, LÍQUIDO BR00372 LUDWIG BIOTECNOLOGIA LTDA 200.99 4 Frasco 2500u 0 803.96 Exibir
42 SÍNTESE DE PRIMERS (ESCALA 10 NMOLES), SEQÜÊNCIA DE OLIGONUCLEOTÍDEOS (20 MER), LIOFILIZADO. SEQÜÊNCIA: 5' ATTTAGGTGACACTATAG 3' (PRIMER SP6). BR00710 LUDWIG BIOTECNOLOGIA LTDA 47.00 4 Kit 0 188.00 Exibir
41 SÍNTESE DE PRIMERS (ESCALA 10 NMOLES), SEQÜÊNCIA DE OLIGONUCLEOTÍDEOS (20 MER), LIOFILIZADO. SEQÜÊNCIA: 5' TAATACGACTCACTATAGGG 3' (PRIMER T7). BR00713 LUDWIG BIOTECNOLOGIA LTDA 47.00 4 Kit 0 188.00 Exibir
40 SÍNTESE DE PRIMERS (ESCALA 10 NMOLES), SEQÜÊNCIA DE OLIGONUCLEOTÍDEOS (20 MER), LIOFILIZADO. SEQÜÊNCIA: 5' GACGTTGTAAAACGACGGCC 3' (PRIMER UNIVERSAL). BR00712 LUDWIG BIOTECNOLOGIA LTDA 41.00 6 Kit 0 246.00 Exibir
39 SÍNTESE DE PRIMERS (ESCALA 10 NMOLES), SEQÜÊNCIA DE OLIGONUCLEOTÍDEOS (20 MER), LIOFILIZADO. SEQÜÊNCIA: 5' CACAGGAAACAGCTATGACC 3' (PRIMER REVERSO). BR00711 LUDWIG BIOTECNOLOGIA LTDA 42.00 6 Kit 0 252.00 Exibir
38 KIT DE PCR, MISTURA DE COMPONENTES NECESSÁRIOS PARA REAÇÃO DE PCR, LÍQUIDO, TAQ DNA POLIMERASE (5000 U/ML), TAMPÃO DE ATIVIDADE DA ENZIMA (10X), MGCL2 (50MM), DNTP BR00489 LUDWIG BIOTECNOLOGIA LTDA 299.87 4 Kit 0 1199.48 Exibir
28 MISTURA DE DEOXINUCLEOTÍDEOS (DNTPS), 25 MM DE CADA (DATP, DTTP, DGTP, DCTP), LÍQUIDO. ARMAZENAR A – 20º C. BR00542 MERCK S/A 206.00 6 Frasco 1ml 0 1236.00 Exibir
48 3-AMINOPROPIL-TRIETOXISILANO, LÍQUIDO CLARO, CORROSIVO, H2N(CH2)3SI(OC2H5)3, 221,37 G/MOL, PUREZA MÍNIMA de 98%, CAS 919-30-2 BR00015 MERCK S/A 142.00 4 Frasco 100ml 0 568.00 Exibir
56 MEMBRANAS DE NITROCELLULOSE PARA BLOTTING, TAMANHO DO PORO 0.2 ΜM, E TAMANHO DAS FOLHAS: 20CM × 20CM BR00525 OMEGA 3 SUPRIMENTOS PARA LABORATORIOS LTDA 300.00 100 Folha 100 0.00
33 AGAROSE, PÓ, PARA ELETROFORESE DE CAMPO PULSADO (PFGE), LIVRE DE DNASE E RNASE, MAIOR OU IGUAL A 1800 G/CM² (GEL A 1%) BR00049 OMEGA 3 SUPRIMENTOS PARA LABORATORIOS LTDA 1900.00 30 Frasco 250g 0 57000.00 Exibir
53 RESINA SEPHADEX® G100 SUPERFINA, RESINA DERIVADA DE DEXTRANA PARA FILTRAÇÃO EM GEL, CAS NUMBER:9050-94-6, TAMANHO DA PARTÍCULA: 20-50ΜM BR00679 ORBITAL PRODUTOS PARA LABORATORIOS -ME 3499.90 2 Frasco 50g 2 0.00
46 CLORETO DE OURO, PÓ CRISTALINO AMARELO OURO/AVERMELHADO,HIGROSCÓPIC, H(AUCL4).3H2O (TETRACLORETO DE OURO TRIHIDRATADO), 393,83 G/MOL, TEOR MÍNIMO DE 48% DE OURO, REAGENTE ACS, CAS 16961-25-4 BR00268 OREGON LABWARE INDUSTRIA IMPORTACAO E EXPORTACAO DE PRODUTOS PARA LABORATORIOS LTDA 173.87 10 Frasco 1g 0 1738.70 Exibir
37 ENZIMA DE RESTRIÇÃO PST I, LÍQUIDO, 10000 U/ML BR00371 PRODIMOL BIOTECNOLOGIA S.A 160.00 4 Frasco 3000un0 0 640.00 Exibir
23 MEIO DE CULTURA, ÁGAR BATATA DEXTROSADO, PÓ BR00523 SCIENCE - COMÉRCIO DE EQUIPAMENTOS PARA LABORATÓRIOS LTDA. 150.00 12 Frasco 500g 0 1800.00 Exibir
35 SUPLEMENTO PARA MEIO DE CULTURA, EXTRATO DE LEVEDURA, PÓ BR00728 SCIENCE - COMÉRCIO DE EQUIPAMENTOS PARA LABORATÓRIOS LTDA. 73.79 12 Frasco 500g 0 885.48 Exibir
27 DODECIL SULFATO DE SÓDIO PARA BIOLOGIA MOLECULAR, CH3(CH2)11OSO3NA, PESO MOLECULAR: 288.38 G/MOL, PÓ, ≥98.5% DE PUREZA BR00357 SCIENCE - COMÉRCIO DE EQUIPAMENTOS PARA LABORATÓRIOS LTDA. 182.89 20 Frasco 500g 0 3657.80 Exibir
77 PENICILINA / ESTREPTOMICINA, FRASCO COM 100 ML BR00602 SIGMA ALDRICH BRASIL LTDA 89.00 6 Frasco 100ml 0 534.00 Exibir
36 ENZIMA DE RESTRIÇÃO ECO RI, LÍQUIDO, 10000 U/ML BR00370 SIGMA ALDRICH BRASIL LTDA 129.50 4 Frasco 500un 0 518.00 Exibir
45 TETRAETOXISILANO (TEOS), LÍQUIDO LÍMPIDO, INCOLOR, ODOR DE ÁLCOOL, (C2H5O)4SI, 208,33 G/MOL,PUREZA MÍNIMA DE 97%, REAGENTE P.A., CAS 78-10-4 BR00765 SIGMA ALDRICH BRASIL LTDA 220.00 4 Frasco 1L 0 880.00 Exibir
49 MEMBRANA DE DIÁLISE : TAMANHO DO PORO 12000 DA (DEVE RETER >90% DO CYTOCHROME C (M.W. 12,400) EM SOLUÇÃO EM PERÍODOS ACIMA DE 10 HORAS). QUALIDADE SIGMA-ALDRICH, E FORNECIDA EM ROLOS, EMBALADOS COM GLICEROL. BR00524 SIGMA ALDRICH BRASIL LTDA 590.00 14 Rolo 25mm larg. 0 8260.00 Exibir
57 AGAROSE, BAIXO PONTO DE FUSÃO, PARA BIOLOGIA MOLECULAR, LIVRE DE DNASE, RNASE E NICKASE. BR00047 SIGMA ALDRICH BRASIL LTDA 1500.00 2 Frasco 500g 0 3000.00 Exibir
60 B-NAD REDUZIDO,SAL DIPOTÁSSICO (Β-NICOTINAMIDE ADENINE DINUCLEOTIDE, REDUCED DIPOTASSIUM SALT), CAS NUMBER 104809-32-7, FÓRMULA: C21H27N7O14P2K2, PUREZA ACIMA DE 98% BR00111 SIGMA ALDRICH BRASIL LTDA 1349.00 2 Frasco 1g 0 2698.00 Exibir
62 COCKTAIL INIBIDOR DE PROTEASE PARA USO EM CÉLULAS DE LEVEDURA E FUNGOS, MISTURA DE INIBIDORES DE PROTEASES DE SERINA, CISTEINA, METALO PROTEASES. CONTEM 4-(2-AMINOETHYL)BENZENESULFONYL FLUORIDE (AEBSF), PEPSTATIN A, E-64, E 1,10-PHENANTHROLINE. EM SOLUÇÃO DE DMSO. BR00278 SIGMA ALDRICH BRASIL LTDA 5604.00 2 Frasco 30ml 0 11208.00 Exibir
63 COCKTAIL INIBIDOR DE PROTEASE PARA USO EM CÉLULAS DE MAMÍFEROS E TECIDOS, MISTURA DE INIBIDORES DE PROTEASES DE SERINA, CISTEINA PROTEASES. CONTEM 4-(2-AMINOETHYL)BENZENESULFONYL FLUORIDE (AEBSF), PEPSTATINA, E-64, BESTATIN, LEUPEPTIN, E APROTININ. NÃO CONTÉM QUELANTES METÁLICOS. EM SOLUÇÃO DE DMSO. BR00279 SIGMA ALDRICH BRASIL LTDA 5676.00 2 Frasco 30ml 0 11352.00 Exibir
64 COCKTAIL INIBIDOR DE PROTEASE PARA USO EM CÉLULAS DE BACTÉRIAS, MISTURA DE INIBIDORES DE PROTEASES DE SERINA, CISTEINA, METALO PROTEASES. CONTEM CONTAINS 4-(2-AMINOETHYL)BENZENESULFONYL FLUORIDE (AEBSF), PEPSTATIN A, E-64, BESTATIN, AND SODIUM EDTA. EM SOLUÇÃO DE DMSO. BR00277 SIGMA ALDRICH BRASIL LTDA 934.00 2 Frasco 25ml 0 1868.00 Exibir
18 SOLUÇÃO TAMPÃO, PH 4,0, CALIBRAGEM DE PEAGÂMETRO BR00721 VETEC QUÍMICA FINA LTDA 10.31 6 Frasco 500ml 0 61.86 Exibir
16 FOSFATO DE SÓDIO, GRÂNULOS BRANCOS CRISTALINOS, NAH2PO4.H2O (MONOBÁSICO,MONOHIDRATADO), 137,99 G/MOL, PUREZA MÍNIMA DE 98%, REAGENTE P.A., CAS 10049-21-5 BR00438 VETEC QUÍMICA FINA LTDA 16.68 6 Frasco 500g 0 100.08 Exibir
44 CORANTE, BROMETO DE ETÍDEO, PÓ. BR00320 VETEC QUÍMICA FINA LTDA 129.99 14 Frasco 5g 0 1819.86 Exibir
3 GLICINA, SÓLIDO, BRANCA, 75,07 MOL, 245°C, ÁCIDO AMINOACÉTICO E C2H502N BR00454 VETEC QUÍMICA FINA LTDA 52.92 5 Frasco 500g 0 264.60 Exibir
15 CITRATO DE SÓDIO, CRISTAL FINO, C6H5NA3O7.2H2O, 294,10 G/MOL, PUREZA MÍNIMA DE 99%, REAGENTE P.A., CAS 6132-04-3 BR00258 VETEC QUÍMICA FINA LTDA 9.96 5 Frasco 500g 0 49.80 Exibir
47 BROMETO DE CETILTRIMETILAMÔNIO, PÓ BRANCO CRISTALINO, (CH3)(CH2)15 N(BR)(CH3)3, 364,45 G/MOL, PUREZA MÍNIMA DE 98%,REAGENTE, CAS 57-09-0 BR00114 VETEC QUÍMICA FINA LTDA 220.80 4 Frasco 500g 0 883.20 Exibir
11 PERSULFATO DE AMÔNIO, LÍQUIDO, (NH4)2S2O8, 228,20 MOL, 98 PER BR00608 VETEC QUÍMICA FINA LTDA 17.40 5 Frasco 100g 0 87.00 Exibir
2 ETILENODIAMINOTETRACÉTICO (EDTA), PÓ BRANCO CRISTALINO, 292,24 G/MOL, C10H16N2O8 (ÁCIDO, ANIDRO), PUREZA MÍNIMA DE 99%, REAGENTE ACS, CAS 60-00-4 BR00400 VETEC QUÍMICA FINA LTDA 57.10 15 Frasco 1kg 0 856.50 Exibir
50 D(+)MALTOSE MONOHIDRATADA, PUREZA IGUAL OU ACIMA DE 99%, SINONIMO:4-O-Α-D-GLUCOPYRANOSYL-D-GLUCOSE, MALTOBIOSE; CAS 6363-53-7, FORMULA:C12H22O11 • H2O. BR00330 VETEC QUÍMICA FINA LTDA 246.00 2 Frasco 500g 0 492.00 Exibir
10 ÓXIDO DE MANGANÊS, PÓ MARROM ESCURO, MNO2, 86,94 G/MOL, PUREZA MÍNIMA DE 90%, REAGENTE P.A., CAS 1313-13-9 BR00556 VETEC QUÍMICA FINA LTDA 71.04 5 Frasco 500g 0 355.20 Exibir
8 FERRICIANETO DE POTASSIO - DESCRIÇÃO COMPLEMENTAR: SAL INORGÂNICO, COMPLEXO INORGÂNICO, 329,26 G/MOL, PÓ CRISTALINO VERMELHO BRILHANTE, INODORO, PUREZA MÍNIMA 99%, FÓRMULA QUÍMICA (K3[FE(CN)6]) BR00416 VETEC QUÍMICA FINA LTDA 27.72 6 Frasco 250g 0 166.32 Exibir
54 ACRILAMIDA, PARA BIOLOGIA MOLECULAR PUREZA ACIMA DE 99%, SINONIMO :ACRYLIC ACID AMIDE, CAS NUMBER:79-06-1 BR00035 VETEC QUÍMICA FINA LTDA 282.99 10 Frasco 500g 0 2829.90 Exibir
7 CLORETO DE SÓDIO, PÓ CRISTALINO BRANCO OU CRISTAIS INCOLORES, 58,45 G/MOL, PUREZA MÍNIMA DE 99,5%, CAS 7647-14-5 BR00273 VETEC QUÍMICA FINA LTDA 4.68 6 Frasco 500g 0 28.08 Exibir
6 FOSFATO DE SÓDIO, PÓ FINO DE CRISTAIS BRANCOS, INODORO, HIGROSCÓPICO, NA2HPO4 (DIBÁSICO ANIDRO), 141,96 G/MOL, PUREZA MÍNIMA DE 99%, REAGENTE P.A., CAS 7558-79-4 BR00439 VETEC QUÍMICA FINA LTDA 17.16 6 Frasco 500g 0 102.96 Exibir
1 TRITON X-100, POLIETILENOGLICOL TERT-OCTIL-FENIL ÉTER, 1,06 G/ML, LÍQUIDO, PUREZA MÍNIMA DE 99,6% BR00776 VETEC QUÍMICA FINA LTDA 82.50 10 Frasco 1L 0 825.00 Exibir
5 SACAROSE, C12H22O11, 98%, 342,31 MOL, PÓ, ANÁLISE QUÍMICA BR00683 VETEC QUÍMICA FINA LTDA 6.96 10 Frasco 500g 0 69.60 Exibir
30 N,N,N,N-TETRAMETIL-ETILENODIAMINA (TEMED), LÍQUIDO CLARO, INCOLOR, ODOR DE AMÔNIA, INFLAMÁVEL, C6H16N2, 116,21 G/MOL, PUREZA MÍNIMA DE 99%, REAGENTE P.A., CAS 110-18-9 BR00546 VETEC QUÍMICA FINA LTDA 57.39 15 Frasco 100ml 0 860.85 Exibir
29 D-GLICOSE, CRISTAL SÓLIDO DE FORMULA MOLECULAR C6H12O6, 180.16 G/MOL, 1,56 G/CM³, TEOR DE PUREZA 98% OU SUPERIOR BR00333 VETEC QUÍMICA FINA LTDA 10.08 10 Frasco 500g 0 100.80 Exibir
61 SODIUM DIETHYLDITHIOCARBAMATE TRIHYDRATE (DIETILDITIOCARBAMATO DE SÓDIO TRIHIDRATADO), CAS NUMBER 20624-25-3, PURISS. P.A., ACS REAGENT, ≥99.0% BR00719 VETEC QUÍMICA FINA LTDA 298.00 2 Frasco 500g 0 596.00 Exibir
26 DITIONITO DE SÓDIO, NA02SSO2NA, PRÓ ANÁLISE (P.A.) BR00353 VETEC QUÍMICA FINA LTDA 14.40 12 Frasco 250g 0 172.80 Exibir
25 NITRITO DE SÓDIO, GRANULADO, BRANCO, 95 PER BR00552 VETEC QUÍMICA FINA LTDA 8.34 6 Frasco 500g 0 50.04 Exibir
22 ACETATO DE POTÁSSIO, KC2H3O2, 98,15 G/MOL, PUREZA MÍNIMA DE 99%, PÓ DE CRISTAIS BRANCOS, FINOS E HIGROSCÓPICOS, CAS 127-08-2, REAGENTE P.A. BR00022 VETEC QUÍMICA FINA LTDA 17.88 6 Frasco 500g 0 107.28 Exibir
20 SOLUÇÃO TAMPÃO, PH 9,0, CALIBRAGEM DE PEAGÂMETRO BR00723 VETEC QUÍMICA FINA LTDA 10.31 6 Frasco 500ml 0 61.86 Exibir
19 SOLUÇÃO TAMPÃO, PH 7,0, CALIBRAGEM DE PEAGÂMETRO BR00722 VETEC QUÍMICA FINA LTDA 10.31 6 Frasco 500ml 0 61.86 Exibir
Valor gasto por fornecedor
Fornecedor Valor(R$)
PRODIMOL BIOTECNOLOGIA S.A 640.0
LUDWIG BIOTECNOLOGIA LTDA 22966.42
SCIENCE - COMÉRCIO DE EQUIPAMENTOS PARA LABORATÓRIOS LTDA. 6343.28
OREGON LABWARE INDUSTRIA IMPORTACAO E EXPORTACAO DE PRODUTOS PARA LABORATORIOS LTDA 1738.7
OMEGA 3 SUPRIMENTOS PARA LABORATORIOS LTDA 57000.0
MERCK S/A 1804.0
VETEC QUÍMICA FINA LTDA 11003.45
CER BRASIL IMPORTACAO E EXPORTACAO S.A. 550.0
DBR COMERCIO E IMPORTACAO DE MATERIAL MEDICO HOSPITALAR 2822.0
SIGMA ALDRICH BRASIL LTDA 40318.0

Valor total de compras simuladas: R$ 0.00     
Valor total comprado da Ata: R$ 145185.85     

Todas as compras Compra 1

(*) Compra marcada como simulada


Voltar